Kiran Babu Tiwari

Childish Middle Age

2012-01-29T20:15:00.003+05:30

Its been feeling childish moments at this middle age. Readings, readings and readings...... Home works, homeworks and homeworks....... Assignments, assignments and assignments......... Unlimited.......

Construction of Listeria monocytogenes ΔtatAC

2012-01-11T03:26:00.002+05:30

सबैको भलो होस

2011-11-19T10:13:00.004+05:30

पहिले पहिले को कुरा , अहिले आएर असान्दर्भिक लाग्न थाल्यो | यो आफ्नो पढाईको साथ साथै ब्यक्तिगत स्वाभाब मा पाएको छु | ती दिन हरु - बीचरा । आफै लाई आफु घाटदै गएको महसुस भएको कुरा सामान्य हुँदै थियो । सम्योग भनु य बध्यता , समय ले रेखा कोर्दो रहेछ । पाइला चाल्नु नयापन भयो, र यो जारी रहने छ । कहिले समय भन्दा अघी भयो, कहिले पछी । तर, यो युयुत्सु अबिरल अबिराम लग्ने छु । रोकिएको थियो बाटो, अब फोहर सफा गर्दै हिंड्नु छ । अरुको कुरा गरेर बिताएको दिन हरु फिर्ता त हुँदैनन्, तर आउने दिन हरुमा आफ्नो कुरा बनाउने परिकल्पना सजाएको छु । सबैको सहयोग (असहयोग्) प्रती म आभारी रहने नै छु । परिवार बाट टाढा हुनु निस्चय नै नरमाइलो महसुश भएको छ । यो पनि जिन्दगी कै अर्को सङ्हर्शा जस्तै भयो । पलायन हुनु पनि युद्द कै अर्को भाग रहेछ । यहाँ पनि त्यस्ता प्रबृत्ती नभएको भने होईन, तर यहाँ सिस्टम भित्र सबै को पहिचान छ । संसार को यथार्थ - समय छोटो छ, र संसार आफै सानो छ । त्यसैले, सबैलाई सबैको कुरा थाहा हुन्छ । कम्तिमा पनि यो मेरो सन्तोस को श्वास हो । हत्यारा, घुस्याहा र बेइमान बाहेक सबैको भलो होस ।

Generation of tatAC-prom-pAZ106 vector

2011-11-16T04:43:00.004+05:30

Generation of tatAC-prom-pAZ106 vector

1. Revival of Listeria monocytogenes and its fur-mutants
2. Grew the bacteria in iron containing and non-iron containing defined media for each strains
3. Extraction to total RNAs from broth cultures for each
4. Performed Real-Time PCR with tatA, tatC, lmo (per) and 16S rRNA genes (Negative result for the first time)
5. Showed down-regulation of tatAC genes in presence of iron
6. Genomic DNA extraction from the bacteria
7. Done PCR (first time - negative result)
8. Done PCR (second time – extremely faint band observed)
9. Third PCR (band intensity was increased with higher template concentration, but negative control was with the band)
10. Fourth PCR (changed the polymerase from Phusion to Taq, but same result)
11. Fifth PCR (changed Taq polymerase, but with the same result)
12. Sixth PCR (used purchased master mix, but with the same result)
13. Seventh PCR (used freshly diluted primers, but with the same result)
14. Designed new primers for different sized (from 123 bp to 500 bp) and different restriction enzymes (from HindIII/EcoRI to BamHI/EcoRI, later ones have compatible buffers) template
15. Eighth PCR (GOOD RESULT!!!)
16. Ninth PCR (used for next step)
17. Restriction digestion with BamHI/EcoRI
18. Purification of the digested products
19. Ligated into pGEM-T vector
20. Transformation of E. coli TOP10
21. Selection of recombinant clone in CIX selective agar
22. Extraction of plasmid (quantitation, about 1 ng/ul)
23. Repeated extraction from broth culture with 100 ug/ml carbenicillin rather than 50 ug/ml (similar yield)
24. Purchased new extraction kit and plasmid extraction (good yield and purity)
25. Restriction digestion (good result)
26. Run agarose gel with large quantity
27. Extraction and purification of the digested tatAC-prom from the gel
28. Revived E. coli pAZ106 culture
29. Cultured in broth for mass growth
30. Extraction of plasmid (pAZ106)
31. Digestion of the plasmid with BamHI/EcoRI
32. Purification of the digested plasmid
33. Ligation of tatAC-prom and pAZ106 vector
34. Transformation of E. coli TOP10
35. Selection of recombinant clone in AE selective agar
36. Selected one out of nine (by individual colony PCRs) clone that might contain tatAC-prom-pAZ106 vector
37. Extracted plasmids from broth culture of the clone
38. Restriction digestion of the plasmid (no result)
39. Repeated digestion with higher concentration of plasmid (GOT THE EXPECTED RESULT!!!)
40. Recommendation: Transformation of listeria

Note:
The promoter was aimed to insert in a shuttle vector (pAZ106) so as to amplify in E. coli and characterized and then expressed in Listeria monocytogenes. Therefore, the restriction sites should have been inserted into the PCR products. The PCR products had an “A” overhang at the 3’ ends, that cannot be cloned into the shuttle vector. Neither, the restriction enzymes were able to digest unmethylated DNAs. So, ATGC residues were also inserted on the PCR products along with restriction sites. Then, pGEM-T linear vector was used for TA – Cloning. The recombinant vector must have been defined after transformation. Then the promoter was excised out from the pGEM-T vector and ligated into pAZ106 vector. The last construct was also defined successfully (see figure).

Standard!!!

2011-10-28T05:24:00.001+05:30

TU ma fail vayera hideko, yaha ko exam ma ta 97.5% aayo. Khattamai rahe6 ni yahako standard ta. Ke garne, je vayo vayo aba................!!!

Ya, got it.......

2011-09-30T07:58:00.006+05:30

Still, I have half answer

2011-09-26T17:17:00.004+05:30

Found the identity of the protein from this putative DNA sequence. Had to roll a lot of stones to find it. Still, I could not find why the professor is doing LR-Recombination and generation of transgenic plant with this gene. I suspect that the homologous genes have role in salt tolerance, but, I am not sure. I had submitted the assignment and let's see what turn it will take.

ATGGAGAGATCTCAACGGCAGTCTCCTCCGCCACCGTCGCCGTCCTCCTCCTCGTCCTCCGTCTCCGCGGACACCGTCCTCGTCCCTCCCGGAAAGAGGCGGAGGGCGGCGACGGCCAAGGCCGGCGCCGAGCCTAATAAGAGGATCCGCAAGGACCCCGCCGCCGCCGCCGCGGGGAAGAGGAGCTCCGTCTACAGGGGAGTCACCAGGCACAGGTGGACGGGCAGGTTCGAGGCGCATCTCTGGGACAAGCACTGCCTCGCCGCGCTCCACAACAAGAAGAAAGGCAGGCAAGTCTACCTGGGGGCGTATGACAGCGAGGAGGCAGCTGCTCGTGCCTATGACCTCGCAGCTCTCAAGTACTGGGGTCCTGAGACTCTGCTCAACTTCCCTGTGGAGGATTACTCCAGCGAGATGCCGGAGATGGAGGCCGTGTCCCGGGAGGAGTACCTGGCCTCCCTCCGCCGCAGGAGCAGCGGCTTCTCCAGGGGCGTCTCCAAGTACAGAGGCGTCGCCAGGCATCACCACAACGGGAGGTGGGAGGCACGGATTGGGCGAGTCTTTGGGAACAAGTACCTCTACTTGGGAACATTTGACACTCAAGAAGAGGCAGCCAAGGCCTATGACCTTGCGGCCATTGAATACCGTGGCGTCAATGCTGTAACCAACTTCGACATCAGCTGCTACCTGGACCACCCGCTGTTCCTGGCACAGCTCCAACAGGAGCCACAGGTGGTGCCGGCACTCAACCAAGAACCTCAACCTGATCAGAGCGAAACCGGAACTACAGAGCAAGAGCCGGAGTCAAGCGAAGCCAAGACACCGGATGGCAGTGCAGAACCCGATGAGAACGCGGTGCCTGACGACACCGCGGAGCCCCTCACCACAGTCGACGACAGCATCGAAGAGGGCTTGTGGAGCCCTTGCATGGATTACGAGCTAGACACCATGTCGAGACCAAACTTTGGCAGCTCAATCAATCTGAGCGAGTGGTTCGCTGACGCAGACTTCGACTGCAACATCGGATGCCTGTTCGATGGGTGTTCTGCGGCTGACGAAGGAAGCAAGGATGGTGTAGGTCTGGCAGATTTCAGTCTGTTTGAGGCAGGTGATGTCCAGCTGAAGGATGTTCTTTCGGATATGGAAGAGGGGATACAACCTCCAGCGATGATCAGTGTGTGCAACTAA

Sequencing SPR1 gene

2011-09-22T04:29:00.006+05:30

The SPR1 gene was taken by digesting SPR1bBluescript plasmid and replaced to T7-Luciferase plasmid in the position of the enzyme (mentioned). The gene was amplified by specific PCR using SPR1BAMF1 and SPR1SACSTOPR1 primers, digested with BamH1 and Sac1, purified and ligated into BamH1/Sac1 digested T7-Luc plasmid. The purified recombinant vector was amplified in Highly competent E. coli NEB 5-alpha cells. The purified plasmid from the cells were used as template for sequencing reaction using 3.2 pmol/microliter T7 promoter primer and 5 pmol/microliter SPR1SACSTOPR1primer in separate reactions to get two (forward and reverse sequencing) results to compare.

Group5 T7 9-20-11.ab1 interpretation:

Sequence obtained:

NNNNNNNNNNNNNNNNNNNNNNNNN AGGGCCCGGATCCATGGGTCGTGGAAACAGCTGTGGTGGAGGTCAAAGCTNNNNNNNNNNTCTCTTTGGTGGTGACGCTCCTGCTCCTAAGCCAGTTCCAGCTCCTCGTCCCGCTCCTACTGAGTCTAACAACGGACCTGCACCACCAGTAACAGCTGTGACTGCAACCGCACTCACGACTGCTACTACTTCTGTTGAGCCTGCAGAGCTTAACAAGCAGATTCCTGCTGGTATCAAAACTCCTGTTAACAACTATGCCAGAGCTGAAGGACAGAACACCGGCAACTTCCTCACTGACCGTCCTTCGACCAAAGTTCACGCAGCTCCGGGAGGAGGATCATCCTTGGATTATCTCTTCACTGGTGGCAAGTAAGAGCTCCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACCGAATTGGCATCACCGGCGCCACAGGTGCGGTTGCTGGCGCCTATATCGCCGACATCACCGATGGGGAAGATCGGGCTCGCCACTTCGGGCTCATGAGCGCTTGTTTCGGCGTGGGTATGGTGGCAGGCCCCGTGGCCGGGGGACTGTTGGGCGCCATCTCCTTGCATGCACCATTCCTTGNGGCGGCGGTGCTCAACGGCCTCAACCTACTACTGGGCTGCTTCCNAATGCAGGAGTCGCATANNNANAGCGTCNAATGNNCACTCTCAGTACNNNCTGCTCTGANGCCGCATANTNNCCANNCCNNNNNCCNNNNNCCNNTNACGCGCCNGANGGNNTGNNNGNNNNNATCNNTNNNANNANNTNNNNNNNGNNNNNNNNTGCATGNNNNNNGTTNNCNNNNNNCNNNNNNNNNNNNNNNNNNNNNNNTNNGNNNNNCNNNNNANNNNNNNNNNNAN

Sequence Analysis using FinchTV image:

First 25 Ntds are not assigned by the sequencer = Ntds in T7 Luc Backbone vector

BamH1 restriction site from 33 – 38 Ntds

SPR1 gene starts from 39^th Ntd

Ntds from 75 – 85: No Ntd was assigned.

Based on the peaks, the Ntds may be CATTGGATTA

The sequence exactly matches in the known SPR1 gene sequence (highlighted)

ATGGGTCGTGGAAACAGCTGTGGTGGAGGTCAAAGCTCATTGGATTATCTCTTTGGTGGTGACGCTCCTGCTCCTAAGCCAGTTCCAGCTCCTCGTCCCGCTCCTACTGAGTCTAACAACGGACCTGCACCACCAGTAACAGCTGTGACTGCAACCGCACTCACGACTGCTACTACTTCTGTTGAGCCTGCAGAGCTTAACAAGCAGATTCCTGCTGGTATCAAAACTCCTGTTAACAACTATGCCAGAGCTGAAGGACAGAACACCGGCAACTTCCTCACTGACCGTCCTTCGACCAAAGTTCACGCAGCTCCGGGAGGAGGATCATCCTTGGATTATCTCTTCACTGGTGGCAAGTAA

Poly A residues were observed from 407 – 436^th positions with short height peaks.

Just before the polyA residues, stop sequence (TAA, 396-398th) and SacI restriction site (399 – 404^th) was found.

Rest of the Ntds must be from vector backbone.

The “Noise” increased after polyA sequence.

The height of the peaks seemed to be vague after 541th Ntd.

After 681th Ntd, the sequence identification was largely inconclusive limiting the size (length) of the sequence. (Actually, the sequencer can sequence good to around 800 Ntds. The lower value might be due to contamination during plasmid preparation. This indication was also observed on the gel electrophoresis result of the digested recombinant construct.)

97% similarities of the sequenced SPR1 gene were observed for all three entries in the NCBI Blasting as: Identifying the unknown Ntds (as n in the query sequence) will completely match the sequences. Therefore, the sequenced result was good.

>ref|NM_001161019.1| Arabidopsis thaliana spiral1 (SPR1) mRNA, complete cds

Length=854

GENE ID: 814896 SPR1 | spiral1 [Arabidopsis thaliana]

(10 or fewer PubMed links)

Score = 628 bits (340), Expect = 2e-178

Identities = 350/360 (97%), Gaps = 0/360 (0%)

Strand=Plus/Plus

Query 14 ATGGGTCGTGGAAACAGCTGTGGTGGAGGTCAAAGCTnnnnnnnnnnTCTCTTTGGTGGT 73

||||||||||||||||||||||||||||||||||||| |||||||||||||

Sbjct 290 ATGGGTCGTGGAAACAGCTGTGGTGGAGGTCAAAGCTCATTGGATTATCTCTTTGGTGGT 349

Query 74 GACGCTCCTGCTCCTAAGCCAGTTCCAGCTCCTCGTCCCGCTCCTACTGAGTCTAACAAC 133

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 350 GACGCTCCTGCTCCTAAGCCAGTTCCAGCTCCTCGTCCCGCTCCTACTGAGTCTAACAAC 409

Query 134 GGACCTGCACCACCAGTAACAGCTGTGACTGCAACCGCACTCACGACTGCTACTACTTCT 193

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 410 GGACCTGCACCACCAGTAACAGCTGTGACTGCAACCGCACTCACGACTGCTACTACTTCT 469

Query 194 GTTGAGCCTGCAGAGCTTAACAAGCAGATTCCTGCTGGTATCAAAACTCCTGTTAACAAC 253

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 470 GTTGAGCCTGCAGAGCTTAACAAGCAGATTCCTGCTGGTATCAAAACTCCTGTTAACAAC 529

Query 254 TATGCCAGAGCTGAAGGACAGAACACCGGCAACTTCCTCACTGACCGTCCTTCGACCAAA 313

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 530 TATGCCAGAGCTGAAGGACAGAACACCGGCAACTTCCTCACTGACCGTCCTTCGACCAAA 589

Query 314 GTTCACGCAGCTCCGGGAGGAGGATCATCCTTGGATTATCTCTTCACTGGTGGCAAGTAA 373

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 590 GTTCACGCAGCTCCGGGAGGAGGATCATCCTTGGATTATCTCTTCACTGGTGGCAAGTAA 649

>ref|NM_126416.2| Arabidopsis thaliana spiral1 (SPR1) mRNA, complete cds

Length=659

GENE ID: 814896 SPR1 | spiral1 [Arabidopsis thaliana]

(10 or fewer PubMed links)

Score = 628 bits (340), Expect = 2e-178

Identities = 350/360 (97%), Gaps = 0/360 (0%)

Strand=Plus/Plus

Query 14 ATGGGTCGTGGAAACAGCTGTGGTGGAGGTCAAAGCTnnnnnnnnnnTCTCTTTGGTGGT 73

||||||||||||||||||||||||||||||||||||| |||||||||||||

Sbjct 95 ATGGGTCGTGGAAACAGCTGTGGTGGAGGTCAAAGCTCATTGGATTATCTCTTTGGTGGT 154

Query 74 GACGCTCCTGCTCCTAAGCCAGTTCCAGCTCCTCGTCCCGCTCCTACTGAGTCTAACAAC 133

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 155 GACGCTCCTGCTCCTAAGCCAGTTCCAGCTCCTCGTCCCGCTCCTACTGAGTCTAACAAC 214

Query 134 GGACCTGCACCACCAGTAACAGCTGTGACTGCAACCGCACTCACGACTGCTACTACTTCT 193

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 215 GGACCTGCACCACCAGTAACAGCTGTGACTGCAACCGCACTCACGACTGCTACTACTTCT 274

Query 194 GTTGAGCCTGCAGAGCTTAACAAGCAGATTCCTGCTGGTATCAAAACTCCTGTTAACAAC 253

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 275 GTTGAGCCTGCAGAGCTTAACAAGCAGATTCCTGCTGGTATCAAAACTCCTGTTAACAAC 334

Query 254 TATGCCAGAGCTGAAGGACAGAACACCGGCAACTTCCTCACTGACCGTCCTTCGACCAAA 313

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 335 TATGCCAGAGCTGAAGGACAGAACACCGGCAACTTCCTCACTGACCGTCCTTCGACCAAA 394

Query 314 GTTCACGCAGCTCCGGGAGGAGGATCATCCTTGGATTATCTCTTCACTGGTGGCAAGTAA 373

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 395 GTTCACGCAGCTCCGGGAGGAGGATCATCCTTGGATTATCTCTTCACTGGTGGCAAGTAA 454

>gb|AY464947.1| Arabidopsis thaliana spiral1 (SPR1) mRNA, complete cds

Length=646

GENE ID: 814896 SPR1 | spiral1 [Arabidopsis thaliana]

(10 or fewer PubMed links)

Score = 628 bits (340), Expect = 2e-178

Identities = 350/360 (97%), Gaps = 0/360 (0%)

Strand=Plus/Plus

Query 14 ATGGGTCGTGGAAACAGCTGTGGTGGAGGTCAAAGCTnnnnnnnnnnTCTCTTTGGTGGT 73

||||||||||||||||||||||||||||||||||||| |||||||||||||

Sbjct 82 ATGGGTCGTGGAAACAGCTGTGGTGGAGGTCAAAGCTCATTGGATTATCTCTTTGGTGGT 141

Query 74 GACGCTCCTGCTCCTAAGCCAGTTCCAGCTCCTCGTCCCGCTCCTACTGAGTCTAACAAC 133

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 142 GACGCTCCTGCTCCTAAGCCAGTTCCAGCTCCTCGTCCCGCTCCTACTGAGTCTAACAAC 201

Query 134 GGACCTGCACCACCAGTAACAGCTGTGACTGCAACCGCACTCACGACTGCTACTACTTCT 193

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 202 GGACCTGCACCACCAGTAACAGCTGTGACTGCAACCGCACTCACGACTGCTACTACTTCT 261

Query 194 GTTGAGCCTGCAGAGCTTAACAAGCAGATTCCTGCTGGTATCAAAACTCCTGTTAACAAC 253

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 262 GTTGAGCCTGCAGAGCTTAACAAGCAGATTCCTGCTGGTATCAAAACTCCTGTTAACAAC 321

Query 254 TATGCCAGAGCTGAAGGACAGAACACCGGCAACTTCCTCACTGACCGTCCTTCGACCAAA 313

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 322 TATGCCAGAGCTGAAGGACAGAACACCGGCAACTTCCTCACTGACCGTCCTTCGACCAAA 381

Query 314 GTTCACGCAGCTCCGGGAGGAGGATCATCCTTGGATTATCTCTTCACTGGTGGCAAGTAA 373

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 382 GTTCACGCAGCTCCGGGAGGAGGATCATCCTTGGATTATCTCTTCACTGGTGGCAAGTAA 441

Failed

2011-09-22T04:12:00.006+05:30

Failed to obtain result of qRT-PCR. This is the first time that I did Real Time PCR. I was expecting enhanced expression of tatA, tatC and per - genes in presence of iron among WT and fur-mutant Listeria monocytogenes. 16S rRNA gene was used as an endogenous control. The most surprising thing is that none of the 3 x 3 x 2 x 4 = 72 reactions was observed with characteristic sigmoid curve; rather all the lines were in log phase only without labeling off. So, the instrument could not calculate Ct value for any of the reaction triplicates. My instructor mentioned that I did wrong somewhere during reaction preparation. However, my boss suspects on quantification of mRNAs and/or cDNAs. Only the thing that I know is I failed the experiment at the first time. I was so scared to report the case to my professor. However, he simply said me to repeat the experiment. I have started right from the beginning - growing bacteria.

Limitation

2011-09-15T05:48:00.003+05:30

Only the limitation that I (we) have is - we do not have our beloved father. Have everything, besides.

Cell Biology

2011-09-02T05:19:00.001+05:30

Cell Biology:

Hey, its Molecular Biology of the Cell. Ya, Molecular Biology. I had to study it, studied. With the great difficulty, I went through some portion of it. Got it. Felt it.

And, probably, you know what I mean. I had an understanding that without knowing the Molecular Biology of eukaryotic cells, one (at least me) could not understand completely the Microbiology. Not all, in my opinion (may be wrong), most of the microbes are in direct or indirect influence of eukaryotic system. Their physiology cannot be understood without, at least, comparing to that of eukaryotes.

Now-a-days, I have a great relief, in my important time, that I carried my understanding of Cell Biology to abroad. The subject that I taught for more than six years in Universal Science College (the then in Maitidevi, Kathmandu) is becoming my tool to understand my Microbiology further.

Hurricane!!! Tornedo!!! Sometimes go for better!!!

2011-08-31T08:40:00.002+05:30

Hurricane!!! Tornedo!!! Sometimes go for better!!!

How many bacteria are present in a microcentrifuge after spinning of overnight log phase growth to extract plasmid? How many plates can be made in a day or week by a student? How many sterile swabs can be prepared?

A mass. The mass can engulf me, you too. Its good. The quality control and efficiency!!! The level of discourse!!! Where we are? I am on the bottom. What did I know? No nothing at all. But insignificant with respect to current time wave. I need to modify myself even in some principles. For example: 5’ cap and 3’ polyA tail of mRNA are for stability, 20,000 – 50,000 genes are present in human, average size of human gene is about 3kbp, two parts of core promoter of a promoter, only 1% of total human chromosome contains protein coding parts, more than 90% of the genes in human have alternate splicing modes, psedogenes, any functional noncoding repeats in DNA (chromosome), two mRNA can be fused to form a new mRNA, 51.1% maternal and 49.9% paternal contribution in human offsprings, etc.

Ya, it hurts. My leg hurts. However, I know this only when other people ask whether your leg hurts or not. I usually forget this for rest of the time in each day. Oh! I should not lie: it hurts when I came to my apartment after the day of work. More than this, my heart hurts. Ya, heart hurts. I didn’t get the chance to soothe it in my home (professional). Expectations were as usual because I did what I know, what I can, what I do best, best for all. Not intentional.

Definitely, missing everyone: mom, wife, brother, sister and her family, son, and all other relatives. All professional relatives. Everything including mustard oil, “besar (I do not know its English name)”, tea. Tears in the eyes: in Kathmandu, Chicago and Illinois – for days. No internet, no phone……!!! Now, I have talked better. Have those.

Hummmm, one thing I should not hide: I regularly have bath in the morning.

Besides my family and all relatives, I, especially, remember those who helped me coming out of one of the difficult moments in the last January. I want to copy of my wall post in my FB (http://www.facebook.com/notes/kiran-babu-tiwari/new-life/180499728657547) posted on Thursday, January 20, 2011 at 6:05am: “Just arrived in home for rest of more than a month after two weeks stay in TU Teaching Hospital due to tragic motorcycle crash..... Am thanking to all who helped me getting new life. Equally to all relatives and friends, I especially am thankful for Prof. Rijal, the nurse in Mananmohan Hospital, Dr. Banjara and his brother, Prof. Tiwari, All medical staffs in TUTH emergency unit. Equally, to Dr. Arjun Lamichhane and Dr. Deepak Mahara's operation team, all the nurses / attendants plus my core family members (with Sanobuwa/Sanima/Kan6idd/Bhai), friends of my brother and Sharmila. I beg sorry if I lost any name involved in the help.”

My sincerity goes to Pradeep sir who gave me a break in Tri-Chandra College, eventhough............

I, always, feel thankfulness and appreciation to Nabaraj sir who helped me to the extreme in those days when I could not move here and there. He picked me up and rode to different colleges and, always, finally to my home. I won't forget such help that I got in my life from him. I haven't have any word to describe his avail.

Dear Ramesh dai, who inspired me for hard work, I love you forever.

Remembering all my friends.....................................

Will write rest.

Enjoy.

New world

2011-08-27T18:08:00.000+05:30

The way diverted to the direction where I should have been (already). I could not be able to get the way without the others' hands and minds, thanks to them. I am very much thankful to you all who helped me track the way. Equally, I am thankful to those who didn't help me get across the thing that I wanted to be done. More than this, I thank to those hands and masterminds who forced me to make a bridge over the oceans. I haven't have any complains to anybody, and won't have. This is because, I never had any intention to misbehave anyone anywhere. Just cool.

Ganesh ji

2011-08-08T20:33:00.002+05:30

Finally, the book has been published

2011-07-16T11:21:00.004+05:30

Finally my book has published from Kantipur College of Medical Science, Sitapaila, Kathmandu.

......................................................................................

Contact:
Kiran Babu Tiwari (Author): kbtiwaree@gmail.com, 00977-9841-374738
College: 00977-1-4279723

...................................................................................

Preface:

Working for years in Central Department of Microbiology, I felt the necessity of a practical hand book on Microbial Genetics and Molecular Biology as a text book with the practical specially designed towards the M. Sc. Microbiology course of Tribhuvan University, Nepal. The aim of this book is to provide basic and advanced practical exercises in microbial genetics and molecular biology useful for masters’ level students and a guideline material for the tutors as well.

While writing this manual, I considered our limited resources and the need to develop experiments that can illustrate and develop concepts in microbial genetics and molecular biology. So the experiments which have been included in the hand book could be carried out in our country context as well.

The hand book explains experiment in such a way that students can understand objectives and principles before starting the procedure. Procedural sections are also written to make the students and tutor/s understand the sequential flow of steps to be carried out. We tried to start from the very beginning: from micropipette calibration through DNA / RNA extraction, analysis of analyte, qualitative and quantitative determination of lac-operon, conjugation, transformation, DNA cloning, PCR to Restriction mapping. Some of the useful information is also attached under annexes. This is one of the efforts to make students and tutors easy in designing and performing experiments. We hope this book will equally be useful to other disciplines of biomedical sciences. Any comments, suggestions for improving this book/manual will be highly appreciated.

I am indebted to Prof. Dr. Shital Raj Basnyat for writing forewords for this book.

.....................................................................................

Contents:
CONTENTS

Orientation: Orientation of Microbial genetics / Molecular Biology Laboratory.................1

Principles: Principle of nucleic acids isolation from bacteria .............................................3

Experiment 1: Calibration of micropipettes ..................5

Experiment 2: Preparation of Tris buffers: Tris-HCl, Tris-EDTA and TAE ....................................7

Experiment 3: Isolation of DNA from human blood......10

Experiment 4a: Extraction of chromosomal DNA from Gram positive bacteria .......................12

Experiment 4b: Extraction of chromosomal DNA from Gram negative bacteria ......................14

Experiment 4c: DNA extraction from yeasts ................16

Experiment 4d: Isolation of nucleic acid (DNA / RNA) from Coliphages .......................................18

Experiment 5a: Extraction of Plasmid DNA from bacteria .......................................................20

Experiment 5b: Isolation and purification of bacterial plasmids using Qiagen spin Miniprep system .............................................22

Experiment 6a: Extraction of RNA from yeasts .............30

Experiment 6b: Extraction of RNA from bacteria ..........32

Experiment 7: Spectrophotometric analysis of DNA in extracted solution ..............................34

Experiment 8: Agarose gel electrophoresis of DNA.......36

Experiment 9a: Demonstration of induction/repression mode of lac-operon regulation system in Escherichia coli..................................40

Experiment 9b: Determination of level of induction of lac-operon in Escherichia coli....................42

Experiment 10: Conjugation in bacteria: Co-culture of MDR Salmonella enteritidis Typhi with Escherichia coli HB101 and detection of transconjugants by antibiotic selection method.............................................44

Experiment 11: Transformation of Escherichia coli HB101 by pUC18 or pBR322..........................46

Experiment 12: Study of performance of HindIII and EcoRI Restriction enzymes stored in lab.........49

Experiment 13a: Construction of recombinant DNA: Preparation and purification of insert (Lambda DNA fragments) and vector (pUC18) DNA ....................................54

Experiment 13b: Construction of recombinant DNA: Ligation of purified insert (Lambda DNA fragments) and vector (pUC18) DNA.....57

Experiment 14a: Amplification of recombinant DNA: Transformation of recombinant pUC18 DNA in Escherichia coli HB101 .............59

Experiment 14b: Detection of recombinant DNA: Extraction of recombinant pUC18 DNA from transformed Escherichia coli HB101 clones .......................................................61

Experiment 14c: Detection of recombinant DNA: Detection of recombinant pUC18 DNA in plasmid extracts of transformed Escherichia coli HB101 clones by agarose gel electrophoresis .................................63

Experiment 15a: Amplification of Escherichia coli DNA (genes) by Polymerase Chain Reaction (PCR) ................................................65

Experiment 15b: Randomly Amplified Polymorphic DNA – Polymerase Chain Reaction (RAPD-PCR) .......................................................68

Experiment 16: Bacterial plasmid profiling....................71

Experiment 17: Construction of simple restriction map of a plasmid DNA .....................................73

ANNEXES

Annex I: Molecular Biology components ............76

Annex IIa: Preparation of buffers.........................78

Annex IIb: Tri buffers ........................................81

Annex III: Phenol .............................................83

Annex IV: Bacterial nucleoid staining ..................85

Annex V: Antibiotic susceptibility testing (AST) of bacteria ...........................................86

Annex VI: Broth dilution method to determine Minimum inhibitory concentration (MIC) .......................................................88

Annes VII: Generation of actinomycete mutants using sodium azide and their analysis..........89

Annex VIII: Replica plating ..................................91

Annex IX: Ames test .........................................94

Annex X: Determination of ciprofloxacin related mutation rate in wild type Salmonella typhi................................................98

Annex XI: Marker - 1 Kb ladder DNA..................100

Annex XIIa: Escherichia coli host strains for transformation ................................102

Annex XIIb: Alpha-Complementation ...................106

Annex XIIIa: Construction of simple restriction map of pBR322 using PstI, HindIII and EcoRI ......................................................107

Annex XIIIb: pUC vectors ....................................111

Annex XIIIc: pBR322 vector ...............................113

Annex XIV: Star activity of Restriction enzymes ....114

Annex XV: PCR calculations ..............................117

Annex XVI: Southern Blotting ............................120

Annex XVII: Ethidium bromide ............................123

Annex XVIII: Molarity of HCl ................................128

Bibliography: Bibliography ....................................129

Am optimistic

2011-05-19T20:53:00.003+05:30

I am optimistic to the latest result from Service Commission (Sewa Aayog) - 2011 (BS 2068), Tribhuvan University; I failed the exam. I understand those who passed did well than what I did. Its true that I am not eligible to teach under a permanent job in the university. However I am doing, at least, my best whereever am working. I congratulate all of them.

New taste

2011-04-12T13:22:00.002+05:30

Working in Tri-Chandra Multiple college is becoming a new taste on me.

Though I wanted to have the taste long ago, I could get some classes to hypnotize people at the 11th hour. The thirst was to self hypnotize my scientific brain after washing hands (made me wash my hands) from Central Department of Microbiology, Tribhuvan University, Kirtipur, where I worked for more than five years.

Directed molecular evolution of broadly crossreactive glycoproteins as modern concept of HIV-vaccine

2011-04-12T13:09:00.001+05:30

BIOTECHNOLOGY SOCIETY OF NEPAL (BSN) E-BULLETIN
VOLUME 2, NOVEMBER 2010
w w w . b s n . o r g . n p i n f o @ b s n . o r g . n p

Review Article

Directed molecular evolution of broadly crossreactive glycoproteins as modern concept of HIV-vaccine

Kiran Babu Tiwari1
1Central Department of Microbology, Tribhuvan University, Kirtipur, Nepal
Tel.: 9841374738, Email: gp120cdnashuffling@gmail.com

Abstract

Development of broadly crossreactive immunogen is utmost important as effective vaccine against HIV. Various methods are employed to develop model vaccines against HIV worldwide; however, none of the attempt became successful yet. Recently, directed molecular evolution of viral surface glycoproteins is being developed to create broadly crossreactive immunogen mimicking natural recombination in HIV.

Keywords: DNA shuffling, HIV, hyperrecombination, vaccine

Link: http://www.bsn.org.np/ebulletin/vol2/

Philosophy of Molecular Genetics

2011-03-26T08:17:00.002+05:30

Philosophy of Molecular Genetics

1. Principles of genetics
Two contradictory principles
1. Fidelity
2. Evolution
Biochemical mechanisms underlying the contradictory requirements for both genetic continuity and the evolution of living organisms

Fidelity:
Many bacteria have nearly same size, shape and internal structures and contain same kinds of precursor molecules and enzymes for 4 billions years
Consistent continuity of inherited traits over millions of years
Transmission of genetic information from generation to generation with high fidelity

DNA polymerase:
• Multisubunit complex
• H-bonding crosschecks
• Processivity, Proofreading
• Error rates: 10-2 - 10-3 (assumed)
• 10-6 - 10-8 (proofreading)
• 10-10 (Mismatch repair and other repair mechanisms)

Structural complementarity
• Any error on one strand can be repaired with the help of complementary strand
• Otherwise – SOS Response in bacteria

Evolution:
• Despite the near perfect fidelity of genetic replication
Infrequent, un-repaired mistakes in the DNA replication occurs
• Change in Ntd sequence or Incorrectly repaired damage -- Changing the instructions for some cellular components -- Handled down to offspring
• Some lethal mutations – organism perish away
• Occasionally a mutation better equips an organism or cell to survive in new environment
• Slightly different specificity (new metabolism): selective advantage to wild type – survive – propel in the new environment
• Occasionally, whole genome is duplicated
• Second copy is superfluous and mutation is not deleterious - new gene/function
Several billions years of adaptive selection have refined cellular systems to take maximum advantage

Genetic material
The molecular nature of genetic material: Why DNA or RNA?
1. Template surfaces for new copy synthesis
2. Template must be in the size range of their products
3. Attraction of opposite versus self
– proteins with aminoacid side chains
– AA should attract same (no specificity) or other (chemically not stable)

Protein as not a good template:
- Val n Ala 1CH3, Val n Iso 1CH3, Gly n Ala 1CH3
– difficult to discriminate
– accounts about 108 times more discrimination strength over Ntd

Proofs for NA as genetic materials
1. Establishing the chemical constitutes of DNA and RNA
2. - 1928: English Microbiologist Fredrick Griffith Transformation
- 1944 – a 10yrs of continuous research American Microbiologist Ostwald T. Avery and his colleagues Colin M MacLeod and Maclyn McCarty at Rockfeller Institute, NY isolated DNA as transforming agent
3. Constant amount of DNA: Beef tissue: Thymus 6.6pg, liver 6.4pg, pancreas 6.9pg, kidney 5.9pg, sperm 3.3pg
4. Chargaff’s rule: Erwin Chargaff 1949: College of Physicians and Surgeons of columbia university
5. W&C 1953: dsDNA

DNA
• Anti-parallel and helical: to fit ribose residues internally
• Complementatrity: to make the sense of double strandedness (DS)
• DS: stabilization by: (a) H-bond, (b) base stacking interactions (largely nonspecific)
• Repair – mismatch / SOS
• Recombination – homologous / site specific

DNA vs RNA
Why DNA is preferred over RNA? Why DS? Why complementarity?
Answer: for repair and stability
(RNA spontaneous hydrolysis)
Double strandedness of DNA: How?

2’-OH of Ribose sugar
Electronegativity of O atom within the vicinity of helix

Rate of NA metabolism
Rate of synthesis and turnover
DNA: 1 turnover/cell cycle; RNA: higher rate
DNA: Master molecule; RNAs: Tools

Level of jobs
DNA: precise replication, passively assist in transcription
RNAs: Extensive (genome, structural, mediator, enzyme)

Why does DNA not contain U?
Uridyl DNA glycosylase
Primitive DNA might contain U
However, U can be problematic
Double carboxy groups per U
Higher rate of tautomer formation

de novo synthesis
1. DNA
1 turnover/per cell cycle,
Master storage for information,
Built in for lowest error rate
• Initial events always error prone
• Must be corrected (removed) later on

RNA primer
Shorter length
Recognition efficiency

2. RNA
Can be synthesized when required
Can be replaced by newer copy
Shorter half life (rapid turnover),
So, less precision as higher investment for higher precision

Super-coiling in chromosome : Compact vs Access????
• Supercoiling: when DNA is subject to some form of structural strains
• Underwound strain: Fewer helical turns than expected in B form
84 / 10.5 = 8
For 7 = 84 / x, x = 12 (12 > 10.5)
• Strain is accompanied by coiling of axis of DNA on itself to form supercoil
• Accommodated by separating two strands over 10.5 Ntd bases length
• As coiling requires less energy than breaking H-bonds that stabilize paired bases
Underwound - easy access
Loosened compact
Easier to separate strands

Higher mutation rates in Virus
Mostly single stranded RNA
Error prone RNA dependant RNA polymerase than DNA dependant RNA polymerase
(that requires ds DNA for transcription)
Highest mutation rates in RNA viruses
Recombination – HIV (diploid genome)

Overlapping genes
Small sized virus to have more number of genes
However effect of mutation
So, better to separate if can be accommodated larger NA

Bacteria
1. Why single replicon? – small unicellular, small chromosome, easy controlling
2. Why higher rate of molecular turnover than eukaryotes?
Size of replicon: Bacteria = 4.6X106Kb, Yeast = 40Kb, Animal = 100Kb
Rate of regional control: Bacteria = 50Kbp/min, Eukaryotes = 2Kbp/min, 1hr/6hr (15% at a time)
3. Why microscopic size? – simple, unicellular (high SA / Vol): So, larger surface for small body
4. Why haploid? – small sized body, only for the metabolic needs, limits the cellular components, lesser quantity of chromosome
5. Why operon (polycistronic)? – small quantity of genome, so related genes must be under a control system, no need of separate controlling strategies that may involve more components - global control
6. Why negative regulation for lac-operon? – Lactose is secondary sugar, primary and ubiquitous is glucose, so presence of glucose should avoid lactose as its metabolism need extra enzymatic step and regulatory apparatus, so should be repressed until need

Organism transition: Prok to Euk
• 2B (2X103X103X103) yrs from prokaryotes
• Cellular communication among differentiated cells/organs
• 3 major changes
• More DNA - fold to compact and discrete complex
• Cells become larger – increased compartmentalization -- Nuclear envelop
• Early eukaryotes - anaerobic – aerobic photosynthetic bacterial symbiosis created photosynthetic plants

• Organism evolution
• Unicellular organisms – advantageous to cluster together for cooperative mobility, efficiency and reproductive successes – permanent associations among individual cells – colony – cellular differentiation

Eukaryotes:
Why introns?
To dilute the rate of mutation as eukaryotic genome is very larger compared to that of bacteria
Larger chromosome - higher probability of random mutation, So incorporation of noncoding sequences largely dilute the effect of mutation within the genes, And, introns are removed during RNA processing

2. Why alleles (diploidy)?
Many introns, however, can increase mutation during processing of RNA with 1 or more Ntd remaining from intron sequence or loss of one or more Ntd from exons. Better to have copies of the gene in homologous positions in the chromosomes, some genes are present in multicopiess

3. Why not operons?
Eukaryotes are more complex having many more components and regulation systems in the cell
Many of the functions can go lethal when aberrant,
Having operon with a control region for some to many genes – single change in the promotor can destroy the operon function killing all the gene,
Moreover, as larger quantity of the DNA can be accommodated, no burden to have separate system of control

4. Why positive regulation of gene expression?
Bacteria: nonrestrictive transcriptional ground state
• RNA polymerase find every promoter in the absence of activators or repressors

Eukaryotes: restrictive transcriptional ground state
• Strong promoters are generally inactive in vivo in the absence of regulatory proteins

Restrictions:
1. by the structure of chromatin (Chromatin remodulation)
2. Transcription and translation separation in both space and time
3. Positive regulation: virtually every eukaryotic gene requires activator for transcription

In positive regulation, most of the genes are normally inactive: The cell synthesizes only the activator proteins needed to promote transcription of the subset of genes required in the cell at that time

Why nuclear envelop?

Sex in not absolutely necessary
Single celled organisms: mitotic division
Many plants: vegetative propagation
Hydra: budding
Sea anemones and marine worms: splitting into halves
Lizards: only female
So, why sexual reproduction ??

Benefit of sex – Recombination
- Higher organisms: haploid phase – simple, brief, diploid – long and proliferation
• Mixing of genomes from parents: Old combinations of genes are broken up and new combinations are created
• Random distribution of maternal and paternal homolog chromosomes
Possible gametes = 2n,, n = haploid no. of chrom., Human: 223 = 8.4 X 106, But, actually >> 223

Chromosomal crossing over – prophase I of meiosis
2 – 3 crossovers on each homologs (chiasmata)
competitive advantage - in an unpredictatively variable environment
As deleterious mutations can not accumulate as bulk in a given memberLeads to the evolution of better survivor

Bacterial identification charts

2010-11-10T11:42:00.001+05:30

Contents of my book

2010-08-09T16:57:00.003+05:30

Working for years, I ever felt the necessity of a practical book on Microbial Genetics and Molecular Biology as a text manual for M. Sc. Microbiology students who are studying in the Central Department of Microbiology and other colleges under or affiliated to Tribhuvan University, Kathmandu, Nepal. The aim of this book is to provide them the basic and advanced practical knowledge in the field.

While writing this manual, I considered our limited resources and facilities, so that experiments that illustrate and develop concepts could be conducted.

The manual explains experiments in such a way that students can understand objectives and principles before procedure. Procedural sections are also written to make the students and tutor/s have a sequential flow of jobs. I tried to maintain gradient of difficulties right from micropipette calibration through DNA / RNA extraction, analysis of analyte, qualitative and quantitative determination of lac-operon, conjugation, transformation, DNA cloning, PCR to Restriction mapping. Many useful information / chapters are attached under annexes.

Author

Kiran Babu Tiwari

Central Department of Microbiology

Tribhuvan University

CONTENTS

Orientation: Orientation of Microbial genetics / Molecular Biology Laboratory

Principles: Principle of nucleic acids isolation from bacteria

Experiment 1: Calibration of micropipettes

Experiment 2: Preparation of different Tris buffers: Tris-HCl, Tris-EDTA and TAE

Experiment 3: Isolation of DNA from human blood

Experiment 4a: Extraction of chromosomal DNA from Gram positive bacteria

Experiment 4b: Extraction of chromosomal DNA from Gram negative bacteria

Experiment 4c: DNA extraction from yeasts

Experiment 4d: Isolation of nucleic acid (DNA / RNA) from Coliphages

Experiment 5a: Extraction of Plasmid DNA from bacteria

Experiment 5b: Isolation and purification of bacterial plasmids with Qiagen spin Miniprep system

Experiment 6a: RNA extraction from yeasts

Experiment 6b: RNA extraction from bacteria

Experiment 7: Spectrophotometric analysis of DNA in extracted solution

Experiment 8: Agarose gel electrophoresis of DNA

Experiment 9a: Demonstration of induction/repression mode of lac-operon regulation system in Escherichia coli

Experiment 9b: Determination of level of induction of lac-operon in Escherichia coli

Experiment 10: Conjugation in bacteria: Co-culture of MDR Salmonella enteritidis Typhi with Escherichia coli HB101 and detection of transconjugants by antibiotic selection method

Experiment 11: Transformation of Escherichia coli HB101 by pUC18 or pBR322

Experiment 12: Study of performance of HindIII and EcoRI Restriction enzymes stored in lab

Experiment 13a: Construction of recombinant DNA: Preparation and purification of insert (Lambda DNA fragments) and vector (pUC18) DNA

Experiment 13b: Construction of recombinant DNA: Ligation of purified insert (Lambda DNA fragments) and vector (pUC18) DNA

Experiment 14a: Amplification of recombinant DNA: Transformation of recombinant pUC18 DNA in Escherichia coli HB101

Experiment 14b: Detection of recombinant DNA: Extraction of recombinant pUC18 DNA from transformed Escherichia coli HB101 clones

Experiment 14c: Detection of recombinant DNA: Detection of recombinant pUC18 DNA in plasmid extracts of transformed Escherichia coli HB101 clones by agarose gel electrophoresis

Experiment 15a: Amplification of Escherichia coli DNA (genes) by Polymerase Chain Reaction (PCR)

Experiment 15b: Randomly Amplified Polymorphic DNA – Polymerase Chain Reaction (RAPD-PCR)

Experiment 16: Bacterial plasmid profiling

Experiment 17: Construction of simple restriction map of plasmid DNA

ANNEXES

Annex I: Molecular Biology components

Annex IIa: Preparation of buffers

Annex IIb: Tri buffers

Annex III: Phenol

Annex IV: Bacterial nucleoid staining

Annex V: Antibiotic susceptibility testing (AST) of bacteria

Annex VI: Broth dilution method to determine Minimum inhibitory concentration (MIC)

Annes VII: Generation of actinomycete mutants using sodium azide and their analysis

Annex VIII: Replica plating

Annex IX: Ames test

Annex X: Determination of ciprofloxacin related mutation rate in wild type Salmonella typhi

Annex XI: 1 Kb ladder DNA

Annex XIIa: Escherichia coli host strains for transformation

Annex XIIb: Alpha-Complementation

Annex XIIIa: Construction of simple restriction map of pBR322 using PstI, HindIII and EcoRI

Annex XIIIb: pUC vectors

Annex XIIIc: pBR322 vector

Annex XIV: Star activity of Restriction enzymes

Annex XV: PCR calculations

Annex XVI: Southern Blotting

Annex XVII: Ethidium bromide

Annex XVIII: Molarity of HCl

Bibliography: Bibliography