Nepali Standard Time

Sunday, January 29, 2012

Childish Middle Age

Its been feeling childish moments at this middle age. Readings, readings and readings...... Home works, homeworks and homeworks....... Assignments, assignments and assignments......... Unlimited.......

Saturday, November 19, 2011

सबैको भलो होस

पहिले पहिले को कुरा , अहिले आएर असान्दर्भिक लाग्न थाल्यो | यो आफ्नो पढाईको साथ साथै ब्यक्तिगत स्वाभाब मा पाएको छु | ती दिन हरु - बीचरा । आफै लाई आफु घाटदै गएको महसुस भएको कुरा सामान्य हुँदै थियो । सम्योग भनु य बध्यता , समय ले रेखा कोर्दो रहेछ । पाइला चाल्नु नयापन भयो, र यो जारी रहने छ । कहिले समय भन्दा अघी भयो, कहिले पछी । तर, यो युयुत्सु अबिरल अबिराम लग्ने छु । रोकिएको थियो बाटो, अब फोहर सफा गर्दै हिंड्नु छ । अरुको कुरा गरेर बिताएको दिन हरु फिर्ता त हुँदैनन्, तर आउने दिन हरुमा आफ्नो कुरा बनाउने परिकल्पना सजाएको छु । सबैको सहयोग (असहयोग्) प्रती म आभारी रहने नै छु । परिवार बाट टाढा हुनु निस्चय नै नरमाइलो महसुश भएको छ । यो पनि जिन्दगी कै अर्को सङ्हर्शा जस्तै भयो । पलायन हुनु पनि युद्द कै अर्को भाग रहेछ । यहाँ पनि त्यस्ता प्रबृत्ती नभएको भने होईन, तर यहाँ सिस्टम भित्र सबै को पहिचान छ । संसार को यथार्थ - समय छोटो छ, र संसार आफै सानो छ । त्यसैले, सबैलाई सबैको कुरा थाहा हुन्छ । कम्तिमा पनि यो मेरो सन्तोस को श्वास हो । हत्यारा, घुस्याहा र बेइमान बाहेक सबैको भलो होस ।

Wednesday, November 16, 2011

Generation of tatAC-prom-pAZ106 vector

Generation of tatAC-prom-pAZ106 vector

1. Revival of Listeria monocytogenes and its fur-mutants
2. Grew the bacteria in iron containing and non-iron containing defined media for each strains
3. Extraction to total RNAs from broth cultures for each
4. Performed Real-Time PCR with tatA, tatC, lmo (per) and 16S rRNA genes (Negative result for the first time)
5. Showed down-regulation of tatAC genes in presence of iron
6. Genomic DNA extraction from the bacteria
7. Done PCR (first time - negative result)
8. Done PCR (second time – extremely faint band observed)
9. Third PCR (band intensity was increased with higher template concentration, but negative control was with the band)
10. Fourth PCR (changed the polymerase from Phusion to Taq, but same result)
11. Fifth PCR (changed Taq polymerase, but with the same result)
12. Sixth PCR (used purchased master mix, but with the same result)
13. Seventh PCR (used freshly diluted primers, but with the same result)
14. Designed new primers for different sized (from 123 bp to 500 bp) and different restriction enzymes (from HindIII/EcoRI to BamHI/EcoRI, later ones have compatible buffers) template
15. Eighth PCR (GOOD RESULT!!!)
16. Ninth PCR (used for next step)
17. Restriction digestion with BamHI/EcoRI
18. Purification of the digested products
19. Ligated into pGEM-T vector
20. Transformation of E. coli TOP10
21. Selection of recombinant clone in CIX selective agar
22. Extraction of plasmid (quantitation, about 1 ng/ul)
23. Repeated extraction from broth culture with 100 ug/ml carbenicillin rather than 50 ug/ml (similar yield)
24. Purchased new extraction kit and plasmid extraction (good yield and purity)
25. Restriction digestion (good result)
26. Run agarose gel with large quantity
27. Extraction and purification of the digested tatAC-prom from the gel
28. Revived E. coli pAZ106 culture
29. Cultured in broth for mass growth
30. Extraction of plasmid (pAZ106)
31. Digestion of the plasmid with BamHI/EcoRI
32. Purification of the digested plasmid
33. Ligation of tatAC-prom and pAZ106 vector
34. Transformation of E. coli TOP10
35. Selection of recombinant clone in AE selective agar
36. Selected one out of nine (by individual colony PCRs) clone that might contain tatAC-prom-pAZ106 vector
37. Extracted plasmids from broth culture of the clone
38. Restriction digestion of the plasmid (no result)
39. Repeated digestion with higher concentration of plasmid (GOT THE EXPECTED RESULT!!!)
40. Recommendation: Transformation of listeria

Note:
The promoter was aimed to insert in a shuttle vector (pAZ106) so as to amplify in E. coli and characterized and then expressed in Listeria monocytogenes. Therefore, the restriction sites should have been inserted into the PCR products. The PCR products had an “A” overhang at the 3’ ends, that cannot be cloned into the shuttle vector. Neither, the restriction enzymes were able to digest unmethylated DNAs. So, ATGC residues were also inserted on the PCR products along with restriction sites. Then, pGEM-T linear vector was used for TA – Cloning. The recombinant vector must have been defined after transformation. Then the promoter was excised out from the pGEM-T vector and ligated into pAZ106 vector. The last construct was also defined successfully (see figure).

Friday, October 28, 2011

Standard!!!

TU ma fail vayera hideko, yaha ko exam ma ta 97.5% aayo. Khattamai rahe6 ni yahako standard ta. Ke garne, je vayo vayo aba................!!!

Friday, September 30, 2011

Monday, September 26, 2011

Still, I have half answer

Found the identity of the protein from this putative DNA sequence. Had to roll a lot of stones to find it. Still, I could not find why the professor is doing LR-Recombination and generation of transgenic plant with this gene. I suspect that the homologous genes have role in salt tolerance, but, I am not sure. I had submitted the assignment and let's see what turn it will take.

ATGGAGAGATCTCAACGGCAGTCTCCTCCGCCACCGTCGCCGTCCTCCTCCTCGTCCTCCGTCTCCGCGGACACCGTCCTCGTCCCTCCCGGAAAGAGGCGGAGGGCGGCGACGGCCAAGGCCGGCGCCGAGCCTAATAAGAGGATCCGCAAGGACCCCGCCGCCGCCGCCGCGGGGAAGAGGAGCTCCGTCTACAGGGGAGTCACCAGGCACAGGTGGACGGGCAGGTTCGAGGCGCATCTCTGGGACAAGCACTGCCTCGCCGCGCTCCACAACAAGAAGAAAGGCAGGCAAGTCTACCTGGGGGCGTATGACAGCGAGGAGGCAGCTGCTCGTGCCTATGACCTCGCAGCTCTCAAGTACTGGGGTCCTGAGACTCTGCTCAACTTCCCTGTGGAGGATTACTCCAGCGAGATGCCGGAGATGGAGGCCGTGTCCCGGGAGGAGTACCTGGCCTCCCTCCGCCGCAGGAGCAGCGGCTTCTCCAGGGGCGTCTCCAAGTACAGAGGCGTCGCCAGGCATCACCACAACGGGAGGTGGGAGGCACGGATTGGGCGAGTCTTTGGGAACAAGTACCTCTACTTGGGAACATTTGACACTCAAGAAGAGGCAGCCAAGGCCTATGACCTTGCGGCCATTGAATACCGTGGCGTCAATGCTGTAACCAACTTCGACATCAGCTGCTACCTGGACCACCCGCTGTTCCTGGCACAGCTCCAACAGGAGCCACAGGTGGTGCCGGCACTCAACCAAGAACCTCAACCTGATCAGAGCGAAACCGGAACTACAGAGCAAGAGCCGGAGTCAAGCGAAGCCAAGACACCGGATGGCAGTGCAGAACCCGATGAGAACGCGGTGCCTGACGACACCGCGGAGCCCCTCACCACAGTCGACGACAGCATCGAAGAGGGCTTGTGGAGCCCTTGCATGGATTACGAGCTAGACACCATGTCGAGACCAAACTTTGGCAGCTCAATCAATCTGAGCGAGTGGTTCGCTGACGCAGACTTCGACTGCAACATCGGATGCCTGTTCGATGGGTGTTCTGCGGCTGACGAAGGAAGCAAGGATGGTGTAGGTCTGGCAGATTTCAGTCTGTTTGAGGCAGGTGATGTCCAGCTGAAGGATGTTCTTTCGGATATGGAAGAGGGGATACAACCTCCAGCGATGATCAGTGTGTGCAACTAA